Genetic transformation of tropical maize (Zea mays L.) inbred line with a phytase gene from Aspergillus nigerS.Geetha#, Beslin Joshi#, K.K.Kumar, L.Arul, E.Kokiladevi, P.Balasubramnaia and D.Sudhakar* # : Authors contributed equally ; *: Corresponding author. Abstract Maize grains are the crucial component of pig and poultry feed.
Phosphorus in maize seeds exists predominately in the form of phytate. Phytate phosphorus isn’t always bio-to be had to monogastric animals and accordingly inorganic phosphate supplementation is carried out for their ideal increase. Transgenic plant seeds expressing phytase enzyme could assist the release of unavailable phosphorus present in the phytate complex into the bio-available form. In this study, a full-length cDNA (phyA; 1.4 kbp) encoding phytase was isolated from Aspergillus niger. The enzyme expressed in E.
coli BL21 cells was characterized. The phyA gene was transformed into maize (Zea mays) inbred line, UMI29 using particle bombardment mediated transformation. Transgenic maize plants over-expressing phytase in maize seeds were produced. PCR and GUS analyses showed the presence of transgene in the T0 transgenic plants and its stable inheritance in the T1 progenies. Three transgenic events expressed detectable level of A.
niger phytase as revealed by Western blot analysis. Phytase activity of 463.158 U/kg of seed was observed in one of the events. Transgenic maize seeds had 5.5 to 7-fold higher phytase activity compared to non-transformed UMI29 seeds and in turn the seeds had 0.6 to 5 fold higher inorganic P content. Key words: Maize, zein promoter, phytate, phytase, endosperm specific expression Abbreviations bpbase pair cDNAcomplementary Deoxyribonucleic acid et al and others kDA Kilo Dalton lpa Low phytic acid P Phosphorus phyA phytase A gene U Unit µM micromolar UMI University Maize Inbred Introduction Maize grain is a main feed grain and a trendy aspect of animal feed where it is used as a supply of strength.
An vital constituent of seeds of pulses and cereals in conjunction with maize is phytic acid (myo-inositol 1,2,3,4,5,6-hexakisphosphate; Ins P6).The salt shape, phytate, is the primary garage shape of phosphate accounting for more than 80 % of the whole phosphorus in cereals and legumes. Beneath normal physiological situations phytic acid chelates crucial minerals which incorporate calcium, magnesium, iron and zinc. Phytic acid likewise ties to amino acids and proteins and hinders stomach related digestive enzymes (Pallauf and Rimbach, 1996). Ruminants are promptly ready to process phytate due to the phytase created by rumen microorganisms.
Phytases (myo-inositol hexakisphosphate phosphohydrolases) hydrolyze phytic corrosive into less phosphorylated myo-inositol subordinates), discharging inorganic phosphate. However, phytate is taken into consideration to be an anti-nutritive compound for monogastric animals as phosphate in phytate shape aren’t bio-to be had as these animals do no longer produce phytase enzyme required to put off phosphate from the inositol within the phytate molecule. To conquer this, supplemental inorganic phosphate is introduced to their feed to fulfill the phosphate requirement and to make sure most beneficial growth. In any case, supplemental inorganic phosphate, for example, monocalcium phosphate or dicalcium phosphae does not expel the counter nutritive impact of phytic corrosive. This may be circumvented with the aid of supplementing feed with phytase enzyme (Simell et al.
1989). Therefore, phytase has become an important industrial enzyme and several commercial products (such as Ronozyme NP, PhyzymeXP, Natuphos) are available for feed-supplementation. However, supplementation of phytase enzyme in animal feed is expensive. Enhancing inorganic P content in grains through breeding is an an alternative and cheaper strategy. This includes, developing crop varieties with reduced level of phytic acid by exploring the naturally available variability through conventional plant breeding strategies (Cichy and Raboy 2008) or engineering crops to express phytase in their seeds (Raboy et al.
2000). Genes encoding phytases have been cloned from diverse sources and characterized which include fungal phytase from Aspergillus ficuum (Ullah 1988), bacterial phytase from Escherichia coli (Greiner et al. 1993) and a mammalian phytase (Craxton et al. 1997).
Phytase from various species of Aspergillus have been over expressed in many transgenic plants (Pen et al. 1993; Verwoerd et al. 1995 and Ullah et al. 1999; Denbow et al.
1998; Ullah et al. 2002; Brinch-Pedersen et al.2000; Zhang et al. 2000; Lucca et al. 2001; Ponstein et al. 2002 and Hong et al. 2004).
Poultry-feeding studies showed that the plant delivered phytase can substitute proportional measure of inorganic phosphate when contrasted with the catalyst created from microbial fermentation (Pen et al. 1993; Denbow et al. 1998 and Zhang et al. 2000). In the present study, an attempt was made to express Aspergillus niger phytase in an Indian tropical maize inbred (UMI 29) with a view to improve its nutritional quality. Materials and Methods Strains The phytase (phyA) gene was isolated from Aspergillus niger 563 strain obtained from National Chemical Laboratory (NCL), Pune, India.
E. coli DH5? was utilized for the maintenance and manipulation of plasmids. Agrobacterium strain LBA4404 was used in genetic transformation studies. Isolation of phytase gene from Aspergillus nigerTotal RNA was extracted from the A. niger following Trizol method as per the manufacturer’s instructions. The full length cDNA sequence was obtained by polymerase chain reaction with RT-PCR kit (RevertAiD™H Minus First Strand cDNA Synthesis Kit # K1631, MBI Fermentas, Germany) using oligonucleotide primers (PHYF – 5′ ATGGGCGTCTCTGCTGTTCTACTTC 3′ and PHYR – 5′ CTAAGCAAAACACTCCGCCCAATC 3′).
The PCR product was purified and cloned into pTZ57R/T vector (MBI Fermentas, Germany) and the vector was named as pTA-phyA. Plasmid DNA sequencing was done and the identity of the cloned phyA gene was confirmed through NCBI BLAST search. The sequence of phyA gene was aligned with seven known homologous genes from other microorganisms by clustalW (Thompson et al. 1997; Larkin et al.
2007). The neighbour joining tree (NJ) was constructed based on the p-distance in software MEGA 5 (Tamura et al. 2007). Expression of phyA gene in E. coli phyA gene was amplified from pTA-phyA plasmid using the primers, ECOF2 (Forward 5′ TCCGAATTCCTGGCAGTCCCCGCCTCGAGA3′) and HINR2 (Reverse5′ CGCAAGCTTAGCTAAGCAAAA CACTCCGCC 3′) with sequences for EcoRI and HindIII restriction sites at the 5′ and 3′ ends, respectively. The EcoRI and HindIII were used to digest the amplified product and the E.
coli expression vector pET-28(a+) (Novagen, madison, WI). Then, vector pET-28(a+)-phyA was created by cloning the coding sequence of phyA into pET-28(a+) expression vector and confirmed by restriction digestion and sequencing. Finally, pET-28(a+)-phyA was transformed into E. coli BL21 competent cells, in which the expression of the phytase protein was induced at 30°C by 1mM isopropyl – ? – D-thiogalacto pyranoside (IPTG) at different induction times (1, 2, 3, 4, 5, 6 and 7 hrs). The protein was analyzed on a 12% SDS-PAGE with empty vector as a control. The resultant phytase protein was purified using BugBuster® His•Bind Purification Kit (catalogue # 70793-3, Novagen, Germany).
The construct of pET-28(a+)-phyA protein was also confirmed by phytase activity assay using the induced culture of E. coli BL21. Phytase activity was estimated colorimetrically by monitoring the release of organic phosphorus from phytic acid as described by Chen et al. (2004). One unit of phytase was defined as the enzyme required to release 1 µmole of inorganic phosphorus per minute from sodium phytate at pH 5.5 and 370 C. Genetic transformation of phyA in maize Plant expression vector construction The open reading frame of phyA was amplified from pTA-phyA using the primers KPF1 (5′-GGTACCATGGGCGTCTCTGCTGTTC-3′) and SPR1 (5′- ACTAGTCTAAGCAAAACTCCGCCC 3′) with KpnI and SpeI restriction sites at the 5′ and 3′ ends of amplified products, respectively.
The phytase expression constructs used for maize transformation consisted of the 1404 bp phyA gene fused with a 90 bp ?- amylase signal peptide to facilitate secretion of the phytase protein into the intracellular space and maize ?-zein (pZSPPHY) or rice glutelin (pTOSPPHY) promoter (Fig. 1). The phosphinothricin resistance gene (bar) was used as the plant selectable marker. Maize zein promoter was isolated earlier in our lab (Geetha 2011) and its endosperm specific expression pattern in rice model system was demonstrated in our lab (Joshi et al. 2015). The pZSPPHY construct harbours gusA besides phyA gene (Fig.
1A) and was co-bombarded with pTRUAX harbouring bar gene (Fig. 1C). The pTOSPPHY construct (Fig. 1B) was co-bombarded with pAHC25 harbouring bar, gusA gene (Fig.1D). Plant materials and genetic transformation Maize plants of UMI 29 inbred (developed by Tamil Nadu Agricultural University, Coimbatore, India) grown under field conditions were used as a source of immature embryos. Immature ears were harvested 8-10 days after self-pollination and sterilized with 70 % ethanol for 1 min followed by 2.5 % sodium hypochlorite for 7 min.
The sterilized ears were rinsed four times with sterilized distilled water. Immature embryos of 1.5 mm in length were aseptically excised from kernels and pre-cultured for 3 – 4 days on N6 callus induction medium (Chu et al. 1975) containing 1 mg/L 2,4-D and 0.4% (w/v) gelrite (Sigma, USA). The pre-cultured immature maize embryos were given 4 h of osmoticum treatment on osmoticum medium (callus induction medium containing 36.4 g/l mannitol and 36.4 g/l sorbitol) in dark and bombarded at 6 cm micro-carrier flying distance at a rupture pressure of 1100 psi twice with DNA coated 0.9 µm diameter gold particles using the PDS 1000/He device (Biorad, USA) with 4 h interval in between. After 16 h of post osmoticum treatment, the bombarded embryos were transferred onto fresh callus induction medium for resting and incubated in dark. After 3 rounds of selection on medium containing phosphinothricin (3 mg/l), the transformed calli was transferred onto regeneration medium (MS medium supplemented with 1 mg/l kinetin and 1 mg/l BAP) and incubated under 16 h of light and 8 h of dark at 25±2 °C in a plant growth chamber.
The 3 – 5 cm length shoots with primary roots were transferred to MS medium (Murashige ; Skoog 1962) and incubated at 25±2 °C with a photoperiod of 16 h light and 8 h dark in a plant growth chamber for elongation of shoots and induction of secondary roots. The plantlets with 2-3 well developed leaves were hardened and transferred to transgenic greenhouse. Molecular and biochemical analyses PCR analysis PCR analysis was carried out for the presence of phyA, gusA gene in the putative transgenic maize plants. Total genomic DNA was isolated from maize leaf using SDS method (0.1 M Tris-HCl pH 8.0; 0.02 M EDTA pH 8.0; 0.1 M NaCl; 1% SDS) as described by Salgado et al. (2006). PCR amplification of phyA, gusA gene and phyA – ADPGPP junction sequence was carried out using sequence specific primers PHYF: ACATCGAAGCCAATTTCACC, PHYR: CATGGG TGAACAGGTCACAG; GUS1F: CAACGAACTGAACTGGCAGA, GUS1R: TTTTTGTCACGCGCTATCAG and INPF2: GAAGATAGCGAATTGGCCGATGAC, ADGPR: GTGCCTTGAACTGCTTTTATTCTT respectively.
High Inorganic Phosphate content (HIP) assay The inorganic phosphate (Pi) content in the maize endosperm tissue was determined using single seed HIP assay (Raboy et al. 2000). Ten seeds were randomly selected from each of the pZSPPHY transformed events (JB-UMI29-17Z, JB-UMI29-30Z), pTOSPPHY transformed event (JB-UMI29-22G) and 6 seeds from pTOSPPHY transformed event (JB-UMI29-20G, since only 12 seeds were available). Endosperm portion was removed from the single seed using sterile scalpel blade. Ten milligrams of endosperm tissue was weighed, crushed, and extracted overnight in 100 µl of 0.4 M HCl at 4°C and 10 ?l of extracts were assayed for Pi using the method of Chen and his co-workers (1956), modified for microtitre plates. To each microtitre plate well were added 10 ?l of extract, 90 ?l distilled, deionized water, and 100 ?l of colorimetric reagent consisting of a 1:1:1:2 mixture of 10 % (w/v) ascorbic acid: 6 N H2SO4 : 2.5 % (w/v) ammonium molybdate : distilled, deionized water.
Each microtitre plate also contained five wells prepared to contain KH2PO4 standard. Following colour development at ambient temperature, results were obtained either via visual inspection of the plates or quantified using a microtitre-plate spectrophotometer (660 nm). Each experiment was replicated thrice along with wild type UMI29 as negative and lpa2 low phytate mutant as a positive control. Western blot analysis Total protein from the endosperm tissues of transgenic maize events, JB-UMI29-17Z/2, JB-UMI29-17Z/3, JB-UMI29-30Z/6, JB-UMI29-20G/4, JB-UMI29-20G/5, JB-UMI29-22G/1 and non-transformed UMI29 was isolated as described by Karaman et al. (2012).
Ten milligrams of powdered endosperm tissue was extracted in 100 µl of protein extraction buffer (200 mM Tris-HCl (pH 8.0), 100 mM NaCl, 400 mM sucrose, 10 mM EDTA, 14 mM 2-BME, 0.05 % tween 20) by incubating on vortex at room temperature for 1 h. Later the suspension was kept at 4° C for 16 h. The mixture was centrifuged at 13000 rpm for 15 min and equal quantity of total protein was loaded in the SDS-PAGE for analysis. After separation on SDS-PAGE, protein amsples were transferred onto a nitrocellulose membrane and western blotting was carried out by Burnette (1981). Purified phytase (obtained in this study) and commercial wheat phytase (Sigma) were used as controls. Phytase assay Phytase assay was carried out in the endosperm tissue of transgenic maize events, JB-UMI29-17Z/2, JB-UMI29-17Z/3, JB-UMI29-30Z/6, JB-UMI29-20G/4, JB-UMI29-20G/5, JB-UMI29-22G/1 and non-transformed UMI29 as described by Chen et al.
(2008). Ten milligrams of powdered endosperm tissue was extracted in 100 µl of extraction buffer (50 mM sodium actetate, 1 mM CaCl2, pH 5.5) under shaking condition at room temperature for 1 h. The tubes were then centrifuged at 3,000 g for 10 min. Supernatant was transferred into fresh tubes and mixed with 900 µl of 5 mM phytic acid and incubated at 37 °C for 30 min.
The reaction was stopped by adding 1 ml of 15 % (v/v) aqueous trichloroacetic acid (TCA). To set up controls, TCA was added to the supernatant first, followed by the phytic acid substrate, and incubated in the same conditions. The released Pi was quantified colormetrically using 0.6 M H2SO4–2 % ascorbic acid–0.5 % ammonium molybdate. Purified phytase and wheat phytase (Sigma) were used as controls.
Standard solutions of potassium phosphate were used as reference. One unit (U) of phytase activity was defined as the amount of activity that liberates 1 µmol of phosphate per min at 37 °C. Statistical analysis The data were analysed using AgRes Statistical Software, Version 3.01 (Pascal International Software Solutions). ANOVA was conducted on the data transformed by arcsine or square root transformation of the percentage or count data, followed by least significant difference (LSD) test to select the best treatment.
Other statistical analysis was performed in worksheet format using Data analysis tool pack feature available in MS Office Excel 2007 software. Results Isolation and sequence analysis of phyA gene The full length cDNA of the phytase gene was isolated and designated as phyA (GenBank accession no. JQ241266) contained a 1404 bp ORF encoding a 467 amino acid protein with a calculated molecular weight of 52 KDa. The predicted PhyA protein shares 100 % identity with Aspergillus awamori phytase (ABA29207) and 99 % with Aspergillus niger (XP0014017130, XM001401676 and AAG40885).
The amino acid sequence from a PhyA contained the consensus motifs RHGXRXP and HD which are conserved among histidine acid phosphatases (Fig.2A). Phylogenetic analysis showed that the phyA formed two clusters. Cluster dendrogram results revealed that the cloned phyA from Aspergillus niger formed a separate cluster with the phytase sequences of other Aspergillus species (Fig.2B). PhyA expression in E. coli The recombinant expression plasmid pET28a(+)-phyA was transferred into E. coli and expression of the target protein was induced by addition of IPTG to cells cultured for 1 to 7 hr, a protein of the expected 52 kDa (Fig.
3A) was expressed and increased in concentration with induction time. This protein was absent in non-induced cells transformed with the same vector. The target protein did not appear in cells transformed with plasmid pET28a(+) without the gene during any of the culture periods. Expression of the target protein maximized at approximately 4 to 7 hr (Fig.3A). Phytase protein was purified from the 100 ml culture (6 hr after induction with 50 mM IPTG) using nickel based His bind resin column. On SDS-PAGE, the purified recombinant enzyme showed a single band of 52 kDa (Fig.3B).
The phytase activity was calculated as 826.33 U/ml for purified phytase and 383.50 U/ml for pET28a(+)-phyA IPTG induced culture (Fig.4). Generation and screening of transgenic maize plants The embryogenic calli obtained from immature embryos after bombardment were sub-cultured thrice on selection medium. Phosphinothricin resistant embryogenic calli on selection media grew well, whereas non-transformed calli turned brown, watery and later dried (Fig. 5). Totally 36 events were regenerated with regeneration efficiency of 11.05 % using pZSPPHY and 32 events with regeneration efficiency of 11.94 % using pTOSPPHY construct.
PCR analysis of the generated transformants PCR analysis of the 36 putative pZSPPHY transformants using GUS1F, GUS1R and PHYF, PHYR resulted in an amplication of 878 bp (gusA) and 190 bp (phyA) in 13 events. Among the 32 events generated using pTOSPPHY construct, 8 events were positive for gusA (878 bp), phyA+ADPGPP (917 bp) and phyA (190 bp) gene sequences in PCR analysis. Inorganic Phosphate level in transformed events In HIP assay, seeds from transgenic plants had higher inorganic P (Pi) levels compared to non-transformed UMI29 control. Among the different transgenic events screened, JB-UMI29-17Z was found to have higher inorganic phosphate level. In JB-UMI29-17Z/2, the inorganic P level was on par with lpa2 mutant (Table 1) and 5 – fold higher compared to non-transformed UMI29 control. Expression of phyA gene in transgenic maize seeds Western blot analysis of the total protein extract from seed endosperm (JB-UMI29-17Z/2, 17Z/3, 30G/6, 20G/4, 20G/5 and 22G/1) showed a strong signal in JB-UMI29-17Z/2, 17Z/3 and a weak signal in 22G/1.
The size of phytase protein produced in transgenic maize plant was slightly higher compared to the purified phytase and was detected at ~62 kDa. No signal was noted in non-transformed UMI29 control (Fig. 6). Phytase activity was measured in the three transgenic events seeds (JB-UMI29-17Z/2, 17Z/3 and 22G/1) that showed phytase activity of 463.15, 412.72, 370.81 U/kg of seed respectively. The increase in phytase activity was about 5.5 to 7-fold in JB-UMI29-22G/1, 17Z/3 and 17Z/2 compared to non-transformed UMI29 seeds (67.45 U/Kg of seed; Fig. 7).
Transgene inheritance The segregation of transgene was studied in JB-UMI29-15Z and JB-UMI29-16Z events transformed with pZSPPHY construct and JB-UMI29-20G and JB-UMI29-22G events transformed with pTOSPPHY construct. PCR and GUS analysis showed that the T1 plants segregated for the transgene, phyA and gusA gene. Discussion Though the importance of maize is centered on the large quantity of carbohydrates, proteins, vitamins and fats, contained in the kernels, the main nutritional limitation of maize grain as food or feed is the presence of phytate complex. At the point when consumed in foods and feeds, phytic acid will tie to healthfully imperative mineral cations that it experiences in the intestinal tract, for example, calcium, iron and zinc, and to proteins too.
This wonder can add to the mineral lack, especially as for iron and zinc. To ease these issues, microorganism determined phytase is ordinarily added to the sustain in territories with pig and poultry generation. An elective system to defeat this issue is to design plants for enhanced phytase activity in the seeds (Dionisio et al. 2011). The present study is an attempt to genetically engineer tropical maize inbred for endosperm specific expression of phytase with a view to improving bioavailability of P and other micronutrients in monogastric animals.
In maize, two phytases, ZmPHYTI and ZmPHYTII have been accounted for in the developing maize seedlings and maize roots (Maugenest et al. 1999) and no phytase has been diagnosed inside the develop mature endosperm (Dionisio et al. 2011). A number of the phytases remoted from various assets, A.
niger phytase, phyA become observed to have the real favored perspective of being dynamic in two pH tiers 2.5 and 5.0 (Holm et al. 2002). In plant, the expressed A. niger phytase turned into dynamic at pH 5.0 alongside these traces diminishing the phytate complicated within the seed and in flip expanding the accessibility of inorganic P at some point of seed development.
The A. niger phytase protein expressed within the hereditarily built maize seeds will anyways stay energetic in the intestine pH 2.5-3.0 of monogastric animals and on this manner processing the leftover phytate inside the entire seed (Han et al., 1999 and Godoi et al., 2017). In this study, a phytase gene (phyA) isolated from the cDNA of A. niger incorporates a single open reading frame of 1404 bp lengthy, which encodes an approximately 52 kDa protein having 467 amino acids. The phytase from A.
niger phyA is well characterized with the aid of several in advance researchers. Average molecular masses of bacterial phytases are smaller than the ones of fungal phytases ((40-55 vs. 80- 120 kDa), specially because of glycosylation differences (Choi et al. 2001; Rodriguez et al. 2000).
From the sequence evaluation it become showed that the amino acid sequence from the phyA cDNA contained the consensus motifs RHGXRXP and HD that are conserved among histidine acid phosphatases. These motifs count on a crucial element within the phosphorylation (Ullah et al. 1991; Van Etten et al. 1991; Kostrewa et al. 1997 and Oh et al. 2001).
An exceptionally conserved sequence motif RHGXRXP (Ullah et al. 1991), related to the catabolic responses, is located at the dynamic sites of phytase. Furthermore, phyA incorporates a far off C-terminal His-Asp motif (HD motif) this is likewise inclined to take part inside the catalysis. Because of the huge potential for use of phytase in the creature nourish industry, several scientists have endeavored to deliver this protein cost-successfully. A.
niger phyA phytase has been cloned and over expressed in several microbial hosts, including S. cerevisiae (Han et al. 1999), P. pastoris (Han and Lei 1999), A. niger (Van Dijck 1999;) and E.
coli (Phillippy and Mullaney 1997). The pET prokaryotic expression system is one of the most effective expression systems, possesses high performance and specific interaction between bacteriophage T7 promoter and T7 RNA polymerase to increase the expression efficacy of exogenous gene in bacteria. The recombinant pET28a(+)-phyA construct expressed the phytase enzyme efficiently in the host E. coli cells. The phytase activity of pET28a(+)-phyA IPTG induced E. coli culture was 383.5 U/ml while it was 826.33 U/ml in purified phytase.
Comparable effects had been determined inside the methylotrophic yeast Pichia pastoris by way of the heterologous expression of Debaryomyces castellii CBS 2923 phytase and maximum production level obtained was 476 U/ml (Ragon et al. 2008). Xiong et al. (2005) and Bei et al.
(2001) reported 865 U/ml and 165 U/ml of enzymatic activity, respectively with A. niger phytase in P. pastoris. Transgenic expression of phytase in maize is turning into a less expensive technique to enhance the bioavailability of phosphorus in food than supplementation of microbial phytase.
In little grained cereals, around 90 % of the seed phytic acid is in the aleurone, and the rest of the 10 % in the scutellum; by differentiate, in maize, 90 % is observed in scutellum and 10 % in aleurone (O’Dell et al. 1972). consequently, there is a strong call for for molecular factors that can control the expression of overseas genes in plant seeds and the promoter is one of the maximum critical types (McElroy and Brettell 1994). In the present study we used rice glutelin promoter, one of the popular endosperm specific promoter to drive the expression of phyA gene.
Besides, we also used maize zein promoter for driving endosperm specific expression. Earlier we have demonstrated that the ?-zein promoter isolated from maize could drive endosperm specific in transgenic rice (Joshi et al. 2015). For genetic transformation studies, we used a tropical inbred, UMI29 which was shown to be amenable for genetic transformation by our laboratory (Joshi et al. 2014, 2016).
Thirty six transgenic plants were obtained using pZSPPHY construct and 32 plants using pTOSPPHY construct. PCR and stable GUS expression studies showed the presence of transgene in the transformants. In order to conclude whether the ectopically expressed phytase can effectively release inorganic P from phytate complex, the inorganic P content of the transgenic seeds were estimated in JB-UMI29-17Z, JB-UMI29-30Z, JB-UMI29-20G and JB-UMI29-22G events. The inorganic P level in the transgenic seeds ranged from 0.79 -2.54 mg/g of seed endosperm, while in control seeds the inorganic P level was 0.51 mg/g. The transgenic seeds showed a 0.6 to 5-fold increase in inorganic P level compared to wild type.
Among the different events screened, the event, JB-UMI29-17Z/2 had maximum inorganic P content of 2.54 mg/g of seed endosperm. This shows that the expression of A. niger phyA gene in endosperm, releases Pi and in turn enhanced the content of Pi. Similarly, expression of A. niger phyA gene using an endosperm specific EGH5 promoter in maize seeds increased the inorganic P level compared to the control (Shen et al.
2008). Preceding reports on transgenic soybean, Arabidopsis and maize flowers over-expressing phytase additionally confirmed phytate discount and Pi growth in transgenic seeds (Chiera et al. 2004; Coello et al. 2001; Chen et al. 2008).
Western blot analysis of the total protein of transgenic maize seed endosperm, showed a detectable level of phyase protein expression in seeds of three events viz., JB-UMI29-17Z/2, 17Z/3 and 22G/1. The plant expressed A. niger phytase was higher in molecular weight compared to the E. coli expressed protein (52 kDa). This shift in molecular weight in plant produced A.
niger phytase may be because of the distinction in glycosylation pattern of the plant produced protein Molecular weight pass of ectopically communicated phytases has additionally been visible in other plant structures like tobacco (Verwoerd et al. 1995), wheat (Brinch-Pedersen et al. 2000) and maize (Chen et al. 2008) and the plant produced Aspergillus phytase molecular size ranged from 60 to 71 kDa. It became additionally pronounced that even though there was a difference in glycosylation pattern inside the plant expressed A.
niger phyA and E. coli appA, they had the identical catalytic assets as that of the native enzyme (Coello et al. 2001; Ullah et al. 2002). Pen and his co-workers (Pen et al. 1993) studied the impact of plant expressed phytase on broiler weight-reduction plan and determined that the inclusion of the transgenic tobacco seeds expressing phyA in animal diets improved the phosphorus availability and broiler growth fee.
A similar observe through Nyannor and Adeola (2008) recommended that E. coli phytase expressed in corn is effective in P usage and might minimize the want for supplemental P in broiler diets. The phytase activity was assayed in the maize seeds that showed detectable amount of phytase protein in Western blot analysis. A maximum phytase activity of 463.15 U/kg of seed was observed in 17Z/2 transgenic seed and the phytase activity of 17Z/3 and 22G/1 were 412.72 and 370.81 U/kg of seed, respectively. The expression of A. niger phytase protein in transgenic maize seeds increased the phytase activity by 5.5 to 7-fold compared to non-transformed UMI29 seeds (67.45 U/kg of seed).
Previous attempts made to express A. niger phytase protein in maize seeds resulted in a maximum increase of phytase activity by 2200-2900 U/kg of seed (Chen et al. 2008; Drakakaki et al. 2005) and least increase in phytase activity by 20.67 U/kg of seed (Shen et al. 2008). Evaluation of T1 progenies confirmed solid integration of transgene and its inheritance in the subsequent era.
The common germination percentage of the T1 seed become 90 % and turned into able to generating normal plant. This shows that the endosperm-particular expression has no negative effect on seed germination and seedling boom. Similar remark was also said earlier by Coello et al. (2001); Yip et al. (2003).
Due to the fact phytate plays an essential role in seed germination, maturation, initiation of dormancy and manage of inorganic phosphate tiers in both developing seeds and seedlings. Phytate reduction underneath a most reliable stage may result in poor germination and seedling growth. Conclusion Aspergillus niger phytase (phyA) gene cloned and expressed in E.coli bacterial expression device. Phytase assay confirmed excessive degree phytase activity inside the E.coli expressed fungal phytase.
Subsequently, phyA gene expressed in a tropical maize inbred line UMI29 in seed specific manner using zein or glutelin promoter. The T1 progeny evaluation showed strong integration and expression of transgenes. Western blot analysis similarly confirmed the expression of A. niger phytase enzyme in transgenic maize seeds. Among different events generated, the event, JB-UMI29-17Z/2 had higher level of phytase activity (463.15 U/kg of seed) with five-fold increase in Pi level (2.54 mg/g) compared to untransformed control maize seeds (0.51 mg/g).
The study proved that it is possible to achieve desirable level of phytase enzyme activity in transgenic tropical maize inbred line. This event could be utilized for transfer of phyA gene into other elite maize lines through backcross breeding to enhance bioavailability of phosphorus in maize grain. Acknowledgements The authors acknowledge Department of Biotechnology, Government of India, New Delhi for funding this research Compliance with ethical standards Conflict of interest The authors declare that they have no conflict of interest. References Bei JL, Z.
Chen L. Yang L, Liao XZ, Wang, Jiang ZY (2001) Overexpression of artificial synthetic gene of Aspergillus niger NRRL3135 phytase in Pichia pastoris. Sheng Wu Gong Cheng Xue Bao 17: 254–258. Brettschneider R, Becker D, Lorz H (1997) Efficient transformation of scutellar tissue of immature maize embryos. Theor.
Appl. Genet 94: 737–748. Brinch-Pedersen H, Olesen A, Rasmussen SK, Holm PB (2000) Generation of transgenic wheat (Triticum aestivum L.) for constitutive accumulation of an Aspergillus phytase. Molecular Breeding 6:195-206. Brinch-Pedersen H, Olesen A,.
Rasmussen SK, Holm PB (2000) Generation of transgenic wheat (Triticum aestivum L.) for constitutive accumulation of an Aspergillus phytase. Mol. Breed 6: 195–206. Brinch-Pedersen H, Sorensen LD, Holm PB (2002) Engineering crop plants: getting a handle on phosphate.
Trends Plant Sci 7: 118-125. Burnette WN (1981) Western blotting: electrophoretic transfer of proteins from sodium dodecyl sulfate—polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Analytical Biochemistry 112(2):195-203 Burr B, Burr FA, John TP, Thomas M, Davis RW (1982) Zein storage protein gene family of maize. J. Mol.
Biol 154: 33-49. Bustos M, Begum D, Kalkan F, Battraw M, Hall TC (1991) Positive and negative cis-acting DNA domains are required for spatial and temporal regulation of gene expression by a seed storage protein promoter. EMBO J 10: 1469–1479. Chandrasekharan MB,. Bishop KJ, Hall TC (2003) Module-specific regulation of the ?-phaseolin promoter during embryogenesis. Plant J 33: 853–866.
Chen CC, Wu PH, Huang CT, Cheng KJ (2004) A Pichia pastoris fermentation strategy for enhancing the heterologous expression of an Escherichia coli phytase. Enzyme Microbial. Technol 35: 315-320. Chen PS, Torribara TY, Warner H (1956) Microdetermination of phosphorous.
Analytical Chemistry 28:1756-1758. Chen R, Xue G, Che P, Yao B, Yang W, Ma Q, Fan Y, Zhao Z, Tarczynski MC, Shi J (2008) Transgenic maize plants expressing a fungal phytase gene. Transgenic Research 17:633-643. Chiera JM, Finer JJ, Grabau EA (2004) Ectopic expression of a soybean phytase in developing seeds of Glycine max to improve phosphorus availability.
Plant Molecular Biology 56:895-904. Choi YM, Suh HJ, Kim JM (2001) Purification and properties of extracellular phytase from Bacillus sp. KHU-10. J.
Protein Chem 20: 287–292. Chu CC, Wang CC, Sun CS, Hsu C, Yin KC, Chu CY, Bi FY (1975) Establishment of an efficient medium for anther culture of rice through comparative experiments on the nitrogen source. Sci Sin 18: 659-668. Cichy KA, Raboy V (2008) Evaluation and development of low phytate crops, In: Krishnan H (ed.) Modification of Seed Composition to Promote Health and Nutrition, Agronomy Monograph 51, American Society of Agronomy and Crop Science Society of America, pp 177–200.
Coello P, Maughan JP, Mendoza A, Philip R, Bollinger DW, Veum TL, Vodkin LO, Polacco JC (2001) Generation of low phytic acid Arabidopsis seeds expressing an E. coli phytase during embryo development. Seed Science Research 11:285-291. Craxton A, Caffrey JJ, Burkhart W, Safrany ST, Shears S.B (1997) Molecular cloning and expression of a rat hepatic multiple inositol polyphosphate phosphatase.
Biochem. J 328: 75-81. Dalal RC (1977) Soil organic phosphorus. Adv.
Agron 29: 83–117. Denbow DM, Grabau EA, Lacy GH, Kornegay ET, Russell DR, Umbeck PF (1998) Soybeans transformed with a fungal phytase gene improve phosphorus availability for broilers. Poult Sci 77: 878–881. Dionisio G, Madsen CK, Holm PB, Welinder KG, Jorgensen M, Stoger E, Arcalis E, Brinch-Pedersen H (2011) Cloning and characterization of purple acid phosphatase phytases from wheat, barley, maize, and rice.
Plant Physiology 156:1087-1100. Drakakaki G, Marcel S, Glahn RP, Lund EK, Pariagh S, Fischer R, Christou P, Stoger E (2005) Endosperm-specific co-expression of recombinant soybean ferritin and Aspergillus phytase in maize results in significant increases in the levels of bioavailable iron. Plant Molecular Biology 59:869-880. El-Itriby AH, Assem SK, Hussein EHA, Abdel-Galil FM, Madkour MA (2003) Regeneration and transformation of Egyptian maize inbred lines via immature embryo culture and biolistic particle delivery system. In Vitro Cell Dev.
Bio.Plant 39: 524-531. Frame BR, Shou H, Chikwamba RK, Zhang Z, Xiang C, Fonger TM, Pegg SEK, Li B, Nettleton DS, Pei D, Wang K (2002) Agrobacterium tumefaciens-mediated transformation of maize embryos using a standard binary vector system. Plant Physiol 129: 13-22. Geetha S (2011) Development of nutrient rich maize cultivar meant for poultry feed through transgenic means.
Dissertation, TamilNadu Agricultral University, Coimbatore, India. Green CE, Phillips RL (1975) Plant regeneration from tissue cultures of maize. Crop Sci 15: 417-421. Greiner R, Konietzny U, Jany KD (1993) Purification and characterization of two phytases from Escherichia coli.
Arch. Biochem. Biophys 303: 107–113. Godoi RR, Andrade SFV, Machado JM, de Souza TPP, Gonçalves AFA, Lopes TB, Parachin NS, Naves LP, Lima WJN, Pereira VV, Galdino AS (2017) Fungal Phytase Production in Different Hosts: A Brief Review. J Microbiol Biotechnol 2(2): 000120. Gutknecht K (1997) Green genes: alfalfa biofarming is about to take root.
Wisconsin Agriculturist, Mid-March, pp.8-10. Han YM, Lei XG (1999) Role of glycosylation in the functional expression of an Aspergillus niger phytase (phyA) in Pichia pastoris. Arch. Biochem.
Biophys 364: 83–90. Han YM,. Wilson DB, Lei XG (1999) Expression of Aspergillus niger phytase gene (phyA) in Saccharomyces cerevisiae. Appl. Environ. Microbiol 65: 1915-1918.
Holm PB, Kristiansen KN, Pedersen HB (2002) Transgenic approaches in commonly consumed cereals to improve iron and zinc content and bioavailability. Journal of Nutrition 132:514-516. Hong CY, Cheng KJ, Tseng TH, Wang CS. Liu LF, Yu SM. (2004) Production of two highly active bacterial phytases with broad pH optima in germinated transgenic rice seeds.
Transgenic Res 13(1): 29–39. Hood EE, Bailey MR, Beifuss K, Magallanes-Lundback M, Horn ME, Callaway E, Drees C, Delaney DE, Clough R, Howard JA (2003) Criteria for high-level expression of a fungal laccase gene in transgenic maize. Plant Biotechnology Journal 1:129-140. Jefferson RA (1987) Assaying chimeric genes in plants: the GUS gene fusion system.
Plant Molecular Biology Reporter 5:387-405. Joshi JB (2013) Genetic engineering of maize for the expression of phytase. Dissertation, TamilNadu Agricultral University, Coimbatore, India. Joshi JB, Geetha S, Birla Singh, Kumar KK, Kokiladevi E, Arul L, Balasubramanian P, Sudhakar D (2015) A maize ?-zein promoter drives an endosperm-specific expression of transgene in rice. Physiol Mol Biol Plants 21(1):35-42. Joshi JB, Kondajji R Yathish, Almaraj John Joel, Kris K Kumar, Easwaran Kokiladevi, Loganathan Arul, Ramasamy Gnanam, Ponnusamy Balasubramanian, Duraialagaraja Sudhakar (2014) A high-throughput regeneration protocol for recalcitrant tropical Indian maize (Zea mays L) inbreds.
Maydica 59(3): 211-216. Joshi JB, Nallathambi G, Kumar KK, Kokiladevi, E. Arul L, Balasubramanian P,. Sudhakar D (2016) An efficient recovery of transgenic plants from a tropical indian maize inbred line. Journal of Microbiology, Biotechnology & Food Sciences. doi: 10.15414/jmbfs.2016.5.4.335-340.
Karaman S, Cunnick J, Wang K (2012) Expression of the cholera toxin B subunit (CT-B) in maize seeds and a combined mucosal treatment against cholera and traveler’s diarrhea. Plant Cell Reports 31:527-537. Kostrewa D, Leitch FG, D’Arcy A, Broger C, Mitchell D, Loon APGM (1997) Crystal structure of phytase from Aspergillus ficuum at 2.5 Åresolution. Nature Struct. Biol, 4: 185–190. Koziel MG, Beland GL, Bowman C, Carozzi NB, Crenshaw R, Crossland L, Dawson J,Desai N, Hill M, Kadwell S, Launis K, Lewis K, Maddox D, McPherson K, Meghji MR, Merlin E, Rhodes R, Warren GW, Wright M, Evola SV (1993) Field performance of elite transgenic maize plants expressing an insecticidal protein derived from Bacillus thuringiensis.
Biotechnology 11: 194–200. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics, 23: 2947–2948. Li J, Hegeman CE, Hanlon RW, Lacy GH, Denbow MD, Grabau EA (1997) Secretion of active recombinant phytase from soybean cell suspension cultures. Plant Physiol 114: 1103–1111. Li J, Hegemann CE, Hanlon RW, Lacy GH, Denbow DM, Grabau EA (1997) Secretion of active recombinant phytase from soybean cell-suspension cultures.
Plant Physiology 114:1103-1111. Li Q, Liu Q, Zhang D, Wang H, Yu H, Gu M, Yao Q (2006) Expression of recombinant phytase in transgenic rice. Chinese Journal of Rice Science 20(3):243-247. Liebert F, Portz L (2007) Different sources of microbial phytase in plant based low phosphorus diets for Nile tilapia Oreochromis niloticus may provide different effects on phytate degradation. Aquaculture 267:292-299.
Lu C, Vasil IK (1983) Improved efficiency of somatic embryogenesis and plant regeneration in tissue cultures of maize (Zea mays L.). Theor. Appl. Genet 66: 285-289.
Lu C, Vasil IK, Akins PO (1982) Somatic embryogenesis in Zea mays L. Theor. Appl. Genet 62: 109-112. Lucca P, Hurrell R, Potrykus I (2001) Genetic engineering approaches to improve the bioavailability and the level of iron in rice grains. Theor.
Appl. Genet 102: 392–397. Marks MD, Lindell JS, Larkins BA (1985) Quantitative analysis of the accumulation of zein mRNA during maize endosperm development. J. Biol. Chem 260: 16445-16450.
Maugenest S, Martinez I, Godin B, Perez P. Lescure AM (1999) Structure of two maize phytase genes and their spatio-temporal expression during seedling development. Plant Molecular Biology 39:503-514. McElroy D, Brettell RIS (1994) Foreign gene expression in transgenic cereals. Trends Biotech 12: 62–68. Mitchell DB, Vogel K, Weimann BJ, Pasamontes L, van Loon AP(1997) The phytase subfamily of histidine acid phosphatases: isolation of two genes for two novel phytases from the fungi Aspergillus terrus and Myceoliophthora thermophila.
Microbiology 143: 245-252. Nyannor EKD, Adeola O (2008) Corn expressing an Escherichia coli-derived phytase gene: comparative evaluation study in broiler chicks. Poultry Science 87(10):2015-2022 O’Dell BL, de Boland AR, Koirtyohann SR (1972) Distribution of phytate and nutritionally important elements among the morphological components of cereal grains. J. Agric.
Food Chem 20: 718–721. O’Kennedy MM, Burger JT, Watson TG (1998) Stable transformation of Hi-II maize using the particle inflow gun. South Afr. J. Sci 94: 188–192. Oduor RO, Njagi ENM, Ndungu S, Machuka JS (2006) In vitro regeneration of dryland Kenyan maize genotypes through somatic embryogenesis.
Int. J. Bot 40: 146-151. Oh BC, Chang BS, Park KH, Ha NC, Kim HK, Oh BH, Oh TK (2001) Calcium-dependent catalytic activity of a novel phytase from Bacillus amyloliquefaciens DS11. Biochemistry 40: 9669–9676.
Paliwal RL, Granados G, Lafitte HR, Violic AD (2000) Tropical Maize Improvement and Production. FAO Plant Production and Protection Series No. 28.FAO, Rome, Italy. Pallauf J, Rimbach G (1996) Nutritional significance of phytic acid and phytase. Arch. Anim.
Nutr 50: 301-319. Pen J, Verwoerd TC, van Paridon PA, Beudeker RF, van den Elzen PJM, Geeres K, vander Klis J, Versteegh HAJ, van Ooyen AJJ, Hoekema A (1993) Phytase-containing transgenic seeds as a novel feed additive for improvement phosphorus utilization. BioTechnology 11:811-814. Pen J, Verwoerd TC, Vanparidon PA, Beudeker RF, Vandenelzen PJM, Geerse K, Vanderklis JD, Versteegh HAJ, Vanooyen AJJ, Hoekema A (1993) Phytase containing transgenic seeds as a novel feed additive for improved phosphorus utilization. Bio/Technology 11: 811–814.
Phillippy BQ, Mullaney EJ (1997) Expression of an Aspergillus niger phytase (phyA) in E. coli. J. Agric. Food Chem 45: 3337–3342.
Ponstein AS, Bade JB, Verwoerd TC, Molendijk L, Storms J, Beudeker RF, Pen J (2002) Stable expression of phytase (phyA) in canola (Brassica napus) seeds towards a commercial product. Mol. Breed 10: 31–44. Raboy V (2002) Progress in breeding low phytate crops.
Journal of Nutrition 132:503-505. Raboy V, Gerbasi PF, Young KA, Stoneberg SD, Pickett SG, Bauman AT, Murthy PPN, Sheridan WF, Ertl DS (2000) Origin and seed phenotype of maize low phytic acid 1-1 and low phytic acid 2-1. Plant Physiology 124:355-368. Ragon M, Roux VN, Chemardin P, Moulin G, Boze HH (2008) Molecular gene cloning and overexpression of the phytase from Debaryomyces castellii CBS 2923. Protein Express. Purif 58: 275–283.
Richardson AE, Hadobas PA, Hayes JE (2001) Extracellular secretion of Aspergillus phytase from Arabidopsis roots enables plants to obtain phosphorus from phytate. Plant Journal 25:641-649 Rodriguez E, Mullaney EJ, Lei XG (2000) Expression of Aspergillus fumigatus phytase gene in Pichia pastoris and characterization of the recombinant enzyme. Biochem.Biophys. Res.
Commun 268: 373–378. Sauter C, Waldner H, Neuhaus UG, Galli A, Neuhaus G, Potrykus I (1991) Micro-targeting: high efficiency gene transfer using a novel approach for the acceleration of micro-projectiles. Bio/technology 9: 1080–1085. Schlappi M, Hohn B (1992) Competence of immature maize embryos for Agrobacterium-mediated gene transfer. Plant Cell 4: 7–16. Shen Y, Wang H, Pan G (2008) Improving inorganic phosphorous content in maize seeds by introduction of phytase gene.
Biotechnology 7(2):323-327 Simell M, Turunen M, Piironen J, Vaara T (1989) Feed and food applications of phytase. Lecture at 3rd Meet. Industrial Applications of Enzymes, Barcelona, Spain. Tamura K, Dudley J, Nei M, Kurmar S (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol.
Biol. Evol 24: 1596–1599 Thompson DJ, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG (1997) The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 24: 4876–4882. Ueda T, Messing J (1993) Manipulation of amino acid balance in maize seeds. Genet. Eng 15: 109–130. Ullah AH, Sethumadhavan K, Mullaney EJ, Ziegelhoffer T, Phillips SA (2003) Fungal phyA gene expressed in potato leaves produces active and stable phytase. Biochem.Biophys. Res. Commun 306: 603–609. Ullah AHJ (1988) Production, rapid purification and catalytic characterization of extracellular phytase from Aspergillus ficuum. Prep. Biochem 18: 443–458. Ullah AHJ, Cummins BJ, Dischinger HCJr (1991) Cyclohexanedione modification of arginine at the active site of Aspergillus ficuum phytase. Biochem.Biophys. Res. Commun 178: 45-53. Ullah AHJ, Sethumadhavan K, Mullaney EJ, Ziegelhoffer T, Phillips SA (1999) Characterization of recombinant fungal phytase (phyA) expressed in tobacco leaves. Biochem.Biophys. Res. Comm 264: 201–206. Ullah AHJ, Sethumadhavan K. Mullaney EJ, Ziegelhoffer T, Austin-Phillips S (2002) Cloned and expressed fungal phyA gene in alfalfa produces a stable phytase. Biochemisty and Biophysics Research Communication 290(4):1343-1348. Utomo SD (2005) The Effect of L-Cysteine on the Efficiency of Agrobacterium mediated transformation of maize. Indonesian J. Agronomy 33: 7–16. Van Dijck PWM (1999) Chymosin and phytase: made by genetic engineering. J. Biotechnol 67: 77–80. Van Etten RL, Davidson R, Stevis PE, H. MacArthur and D.L. Moore. 1991. Covalent structure, disulfide bonding, and identification of reactive surface and active site residues of human prostatic acid phosphatase. J. Biol. Chem., 266: 2313–2319. Van Gorcom RFM, van Hartingsveldt W, van Paridon PA, Veenstra AE, Luiten RGM, Selten GCM(1991) Cloning and expression of microbial phytase. EPA 0 420 358, EPA, Washington, D.C. Vasil V, Vasil IK, Lu C (1984) Somatic embryogenesis in longterm callus cultures of Zea mays L. (Gramineae). Amer. J. Bot 71: 158-161. Verwoerd TC, van Paridon PA, van Ooyen AJ, van Lent JW, Hoekema A, PenJ (1995) Stable accumulation of Aspergillus niger phytase in transgenic tobacco leaves. Plant Physiol 109(4): 1199–1205. Ward KA, Jordan MC (2001) Callus formation and plant regeneration from immature and mature embryos of rye (Secale cereale L.). In Vitro Cell Dev. Biol. Plant 37: 361-368. Wyss M, Brugger R, Kronenberger A, Remy R, Fimbel R, Oesterhelt G, Lehmann M, van Loon AP (1999) Biochemical characterization of fungal phytases (myo-inositol hexakisphosphate phosphohydrolases): catalytic properties. Appl. Environ. Microbiol 65: 367–373. Xiong AS, Yao QH, Peng RH, Han PL, Cheng ZM, Li Y (2005) High level expression of a recombinant acid phytase gene in Pichia pastoris.J. Appl. Microbiol 98: 418–428. Yip W, Wang L, Cheng C, Wu W, Lung S, Lim BL (2003) The introduction of a phytase gene from Bacillus subtilis improved the growth performance of transgenic tobacco. Biochemistry and Biophysics Research Communication 310:1148-1154. Zhang ZB, Kornegay ET, Radcliffe JS, Denbow DM, Veit HP, Larsen CT (2000) Comparison of genetically engineered microbial and plant phytases for young broilers. Poultry Sci 79: 709–717. Table 1 HIP assay in transgenic maize seeds expressing Aspergillus niger phytase Event no Seed no Amount of inorganic phosphate (in mg/g) pZSPPHY transformed plants 17Z 2 2.54 ± 0.05a 3 2.35 ± 0.06b 7 1.89 ± 0.05c 30Z 6 0.90 ± 0.02e 8 0.79 ± 0.01e pTOSPPHY transformed plants 20G 4 0.97 ± 0.01e 5 1.34 ± 0.01d 22G 1 0.98 ± 0.02e UMI29 0.51 ± 0.08f lpa2 2.73 ± 0.27a Each treatment was replicated 3 times and the values presented are as mean ± SE followed by alphabets to imply significant difference (p ?0.05) after grouping of treatment means after ANOVA by LSD and values with same letter are not significantly different.
